Novel genetic polymorphisms in DNA repair genes: O(6)-methylguanine-DNA methyltransferase (MGMT) and N-methylpurine-DNA glycosylase (MPG) in lung cancer patients from Poland. 1999

M Rusin, and A Samojedny, and C C Harris, and M Chorazy
Department of Tumor Biology, Institute of Oncology, ul. Wybrzeze AK 15, 44-100 Gliwice, Poland. rusinm@rocketmail.com

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.

UI MeSH Term Description Entries
D008175 Lung Neoplasms Tumors or cancer of the LUNG. Cancer of Lung,Lung Cancer,Pulmonary Cancer,Pulmonary Neoplasms,Cancer of the Lung,Neoplasms, Lung,Neoplasms, Pulmonary,Cancer, Lung,Cancer, Pulmonary,Cancers, Lung,Cancers, Pulmonary,Lung Cancers,Lung Neoplasm,Neoplasm, Lung,Neoplasm, Pulmonary,Pulmonary Cancers,Pulmonary Neoplasm
D009699 N-Glycosyl Hydrolases A class of enzymes involved in the hydrolysis of the N-glycosidic bond of nitrogen-linked sugars. Glycoside Hydrolases, Nitrogen-linked,Hydrolases, N-Glycosyl,Nucleosidase,Nucleosidases,Nucleoside Hydrolase,Nitrogen-linked Glycoside Hydrolases,Nucleoside Hydrolases,Glycoside Hydrolases, Nitrogen linked,Hydrolase, Nucleoside,Hydrolases, N Glycosyl,Hydrolases, Nitrogen-linked Glycoside,Hydrolases, Nucleoside,N Glycosyl Hydrolases,Nitrogen linked Glycoside Hydrolases
D011044 Poland A country in central Europe, east of Germany. The capital is Warsaw. Polish People's Republic,Republic of Poland
D011110 Polymorphism, Genetic The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level. Gene Polymorphism,Genetic Polymorphism,Polymorphism (Genetics),Genetic Polymorphisms,Gene Polymorphisms,Polymorphism, Gene,Polymorphisms (Genetics),Polymorphisms, Gene,Polymorphisms, Genetic
D002289 Carcinoma, Non-Small-Cell Lung A heterogeneous aggregate of at least three distinct histological types of lung cancer, including SQUAMOUS CELL CARCINOMA; ADENOCARCINOMA; and LARGE CELL CARCINOMA. They are dealt with collectively because of their shared treatment strategy. Carcinoma, Non-Small Cell Lung,Non-Small Cell Lung Cancer,Non-Small Cell Lung Carcinoma,Non-Small-Cell Lung Carcinoma,Nonsmall Cell Lung Cancer,Carcinoma, Non Small Cell Lung,Carcinomas, Non-Small-Cell Lung,Lung Carcinoma, Non-Small-Cell,Lung Carcinomas, Non-Small-Cell,Non Small Cell Lung Carcinoma,Non-Small-Cell Lung Carcinomas
D004742 Enhancer Elements, Genetic Cis-acting DNA sequences which can increase transcription of genes. Enhancers can usually function in either orientation and at various distances from a promoter. Enhancer Elements,Enhancer Sequences,Element, Enhancer,Element, Genetic Enhancer,Elements, Enhancer,Elements, Genetic Enhancer,Enhancer Element,Enhancer Element, Genetic,Enhancer Sequence,Genetic Enhancer Element,Genetic Enhancer Elements,Sequence, Enhancer,Sequences, Enhancer
D006801 Humans Members of the species Homo sapiens. Homo sapiens,Man (Taxonomy),Human,Man, Modern,Modern Man
D045647 DNA Glycosylases A family of DNA repair enzymes that recognize damaged nucleotide bases and remove them by hydrolyzing the N-glycosidic bond that attaches them to the sugar backbone of the DNA molecule. The process called BASE EXCISION REPAIR can be completed by a DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE which excises the remaining RIBOSE sugar from the DNA. DNA N-glycosidase,DNA Glycosylase,Methylpurine DNA Glycosylase,DNA Glycosylase, Methylpurine,DNA N glycosidase,Glycosylase, DNA,Glycosylase, Methylpurine DNA,Glycosylases, DNA
D019853 O(6)-Methylguanine-DNA Methyltransferase An enzyme that transfers methyl groups from O(6)-methylguanine, and other methylated moieties of DNA, to a cysteine residue in itself, thus repairing alkylated DNA in a single-step reaction. EC 2.1.1.63. Methylated-DNA-Protein-Cysteine S-Methyltransferase,O(6)-AGT,O(6)-Methylguanine Methyltransferase,DNA Repair Methyltransferase I,DNA Repair Methyltransferase II,Guanine-O(6)-Alkyltransferase,O(6)-Alkylguanine-DNA Alkyltransferase,O(6)-MeG-DNA Methyltransferase,O(6)-Methylguanine DNA Transmethylase,Methylated DNA Protein Cysteine S Methyltransferase,S-Methyltransferase, Methylated-DNA-Protein-Cysteine

Related Publications

M Rusin, and A Samojedny, and C C Harris, and M Chorazy
July 1998, FEBS letters,
M Rusin, and A Samojedny, and C C Harris, and M Chorazy
January 2003, Anticancer research,
M Rusin, and A Samojedny, and C C Harris, and M Chorazy
January 2002, Anticancer research,
M Rusin, and A Samojedny, and C C Harris, and M Chorazy
January 2000, Anticancer research,
M Rusin, and A Samojedny, and C C Harris, and M Chorazy
June 2001, Mutation research,
M Rusin, and A Samojedny, and C C Harris, and M Chorazy
March 2014, Molecular carcinogenesis,
M Rusin, and A Samojedny, and C C Harris, and M Chorazy
February 2012, Neurosurgery,
M Rusin, and A Samojedny, and C C Harris, and M Chorazy
February 2022, Journal of neurosurgical sciences,
M Rusin, and A Samojedny, and C C Harris, and M Chorazy
January 2011, Cancer biomarkers : section A of Disease markers,
Copied contents to your clipboard!