Biomaterial Database

[Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene]. 1986

I V Boni, and D M Isaeva, and E I Budovskiĭ

The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene. The possible spatial proximity between these two regions is discussed.

UI	MeSH Term	Description	Entries
D011777	Q beta Replicase	An enzyme that catalyzes the replication of the RNA of coliphage Q beta. EC 2.7.7.-.	Qbeta Replicase,Replicase, Q beta,Replicase, Qbeta,beta Replicase, Q
D003090	Coliphages	Viruses whose host is Escherichia coli.	Escherichia coli Phages,Coliphage,Escherichia coli Phage,Phage, Escherichia coli,Phages, Escherichia coli
D004926	Escherichia coli	A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.	Alkalescens-Dispar Group,Bacillus coli,Bacterium coli,Bacterium coli commune,Diffusely Adherent Escherichia coli,E coli,EAggEC,Enteroaggregative Escherichia coli,Enterococcus coli,Diffusely Adherent E. coli,Enteroaggregative E. coli,Enteroinvasive E. coli,Enteroinvasive Escherichia coli
D005814	Genes, Viral	The functional hereditary units of VIRUSES.	Viral Genes,Gene, Viral,Viral Gene
D001483	Base Sequence	The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.	DNA Sequence,Nucleotide Sequence,RNA Sequence,DNA Sequences,Base Sequences,Nucleotide Sequences,RNA Sequences,Sequence, Base,Sequence, DNA,Sequence, Nucleotide,Sequence, RNA,Sequences, Base,Sequences, DNA,Sequences, Nucleotide,Sequences, RNA
D012269	Ribosomal Proteins	Proteins found in ribosomes. They are believed to have a catalytic function in reconstituting biologically active ribosomal subunits.	Proteins, Ribosomal,Ribosomal Protein,Protein, Ribosomal
D012270	Ribosomes	Multicomponent ribonucleoprotein structures found in the CYTOPLASM of all cells, and in MITOCHONDRIA, and PLASTIDS. They function in PROTEIN BIOSYNTHESIS via GENETIC TRANSLATION.	Ribosome
D012316	RNA Nucleotidyltransferases	Enzymes that catalyze the template-directed incorporation of ribonucleotides into an RNA chain. EC 2.7.7.-.	Nucleotidyltransferases, RNA
D012367	RNA, Viral	Ribonucleic acid that makes up the genetic material of viruses.	Viral RNA