Biomaterial Database

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus. 1980

H Hori, and S Osawa, and K Murao, and H Ishikura

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

UI	MeSH Term	Description	Entries
D008837	Micrococcus	A genus of gram-positive, spherical bacteria found in soils and fresh water, and frequently on the skin of man and other animals.
D008970	Molecular Weight	The sum of the weight of all the atoms in a molecule.	Molecular Weights,Weight, Molecular,Weights, Molecular
D009690	Nucleic Acid Conformation	The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.	DNA Conformation,RNA Conformation,Conformation, DNA,Conformation, Nucleic Acid,Conformation, RNA,Conformations, DNA,Conformations, Nucleic Acid,Conformations, RNA,DNA Conformations,Nucleic Acid Conformations,RNA Conformations
D004926	Escherichia coli	A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.	Alkalescens-Dispar Group,Bacillus coli,Bacterium coli,Bacterium coli commune,Diffusely Adherent Escherichia coli,E coli,EAggEC,Enteroaggregative Escherichia coli,Enterococcus coli,Diffusely Adherent E. coli,Enteroaggregative E. coli,Enteroinvasive E. coli,Enteroinvasive Escherichia coli
D001412	Bacillus subtilis	A species of gram-positive bacteria that is a common soil and water saprophyte.	Natto Bacteria,Bacillus subtilis (natto),Bacillus subtilis subsp. natto,Bacillus subtilis var. natto
D001482	Base Composition	The relative amounts of the PURINES and PYRIMIDINES in a nucleic acid.	Base Ratio,G+C Composition,Guanine + Cytosine Composition,G+C Content,GC Composition,GC Content,Guanine + Cytosine Content,Base Compositions,Base Ratios,Composition, Base,Composition, G+C,Composition, GC,Compositions, Base,Compositions, G+C,Compositions, GC,Content, G+C,Content, GC,Contents, G+C,Contents, GC,G+C Compositions,G+C Contents,GC Compositions,GC Contents,Ratio, Base,Ratios, Base
D001483	Base Sequence	The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.	DNA Sequence,Nucleotide Sequence,RNA Sequence,DNA Sequences,Base Sequences,Nucleotide Sequences,RNA Sequences,Sequence, Base,Sequence, DNA,Sequence, Nucleotide,Sequence, RNA,Sequences, Base,Sequences, DNA,Sequences, Nucleotide,Sequences, RNA
D012335	RNA, Ribosomal	The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)	Ribosomal RNA,15S RNA,RNA, 15S
D013045	Species Specificity	The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.	Species Specificities,Specificities, Species,Specificity, Species