Biomaterial Database

Nucleotide sequence and secondary structure analysis of spinach chloroplast 4.5 S RNA. 1982

I Kumagai, and T Pieler, and A R Subramanian, and V A Erdmann

The nucleotide sequence of the 4.5 S ribosomal RNA from Spinacia oleracea chloroplast has been determined to be HOAGAGAAGGUCACGGCGAGACGAGCCGUUUAUCAUUAC GAUAGGUGUCAAGUGGAAGUGCAGUGAUGUAUGCAGCUGAGGCAUCCUAACAGACCCACAGACUUGAACOH using rapid gel sequencing techniques. This RNA contains 106 nucleotides including an AGA sequence at the 5'-end not found in other chloroplast 4.5 S RNAs and a seven-nucleotide segment absent in the sequences of wheat and maize 4.5 S RNAs. Except for these differences, the sequence of spinach 4.5 S RNA is highly homologous with those of other species. It shows 95% sequence homology to that of tobacco and 78% homology to those of wheat and maize. The secondary structure was probed using limited ribonuclease T1 and nuclease S1 digestions. The results support the 5'-half of the secondary structure model previously proposed for 4.5 S RNA (Machatt, M. A., Ebel, J.-P., and Branlant, C. (1981) Nucleic Acids Res. 9, 1533-1549) but are inconsistent with the rest of that model. An alternative model for spinach 4.5 S RNA is discussed.

UI	MeSH Term	Description	Entries
D009690	Nucleic Acid Conformation	The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.	DNA Conformation,RNA Conformation,Conformation, DNA,Conformation, Nucleic Acid,Conformation, RNA,Conformations, DNA,Conformations, Nucleic Acid,Conformations, RNA,DNA Conformations,Nucleic Acid Conformations,RNA Conformations
D010944	Plants	Multicellular, eukaryotic life forms of kingdom Plantae. Plants acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations. It is a non-taxonomical term most often referring to LAND PLANTS. In broad sense it includes RHODOPHYTA and GLAUCOPHYTA along with VIRIDIPLANTAE.	Plant
D002736	Chloroplasts	Plant cell inclusion bodies that contain the photosynthetic pigment CHLOROPHYLL, which is associated with the membrane of THYLAKOIDS. Chloroplasts occur in cells of leaves and young stems of plants. They are also found in some forms of PHYTOPLANKTON such as HAPTOPHYTA; DINOFLAGELLATES; DIATOMS; and CRYPTOPHYTA.	Chloroplast,Etioplasts,Etioplast
D006163	Ribonuclease T1	An enzyme catalyzing the endonucleolytic cleavage of RNA at the 3'-position of a guanylate residue. EC 3.1.27.3.	Guanyloribonuclease,RNase T1,Ribonuclease N1,Aspergillus oryzae Ribonuclease,Guanyl-Specific RNase,RNase Apl,RNase F1,RNase Pch 1,RNase ST,Ribonuclease F1,Ribonuclease F2,Ribonuclease ST,Ribonuclease T-1,T 1 RNase,Guanyl Specific RNase,RNase, Guanyl-Specific,RNase, T 1,Ribonuclease T 1,Ribonuclease, Aspergillus oryzae
D001483	Base Sequence	The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.	DNA Sequence,Nucleotide Sequence,RNA Sequence,DNA Sequences,Base Sequences,Nucleotide Sequences,RNA Sequences,Sequence, Base,Sequence, DNA,Sequence, Nucleotide,Sequence, RNA,Sequences, Base,Sequences, DNA,Sequences, Nucleotide,Sequences, RNA
D012335	RNA, Ribosomal	The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)	Ribosomal RNA,15S RNA,RNA, 15S