Biomaterial Database

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum. 1981

H Hori, and M Sawada, and S Osawa, and K Murao, and H Ishikura

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

UI	MeSH Term	Description	Entries
D008970	Molecular Weight	The sum of the weight of all the atoms in a molecule.	Molecular Weights,Weight, Molecular,Weights, Molecular
D009174	Mycoplasma	A genus of gram-negative, mostly facultatively anaerobic bacteria in the family MYCOPLASMATACEAE. The cells are bounded by a PLASMA MEMBRANE and lack a true CELL WALL. Its organisms are pathogens found on the MUCOUS MEMBRANES of humans, ANIMALS, and BIRDS.	Eperythrozoon,Haemobartonella,Mycoplasma putrefaciens,PPLO,Pleuropneumonia-Like Organisms,Pleuropneumonia Like Organisms
D009690	Nucleic Acid Conformation	The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.	DNA Conformation,RNA Conformation,Conformation, DNA,Conformation, Nucleic Acid,Conformation, RNA,Conformations, DNA,Conformations, Nucleic Acid,Conformations, RNA,DNA Conformations,Nucleic Acid Conformations,RNA Conformations
D001483	Base Sequence	The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.	DNA Sequence,Nucleotide Sequence,RNA Sequence,DNA Sequences,Base Sequences,Nucleotide Sequences,RNA Sequences,Sequence, Base,Sequence, DNA,Sequence, Nucleotide,Sequence, RNA,Sequences, Base,Sequences, DNA,Sequences, Nucleotide,Sequences, RNA
D012335	RNA, Ribosomal	The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)	Ribosomal RNA,15S RNA,RNA, 15S