BIOMAT Database Logo BIOMAT Database Logo

Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support. 1980

A F Markham, and M D Edge, and T C Atkinson, and A R Greene, and G R Heathcliffe, and C R Newton, and D Scanlon

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.

UI MeSH Term Description Entries
D007202 Indicators and Reagents Substances used for the detection, identification, analysis, etc. of chemical, biological, or pathologic processes or conditions. Indicators are substances that change in physical appearance, e.g., color, at or approaching the endpoint of a chemical titration, e.g., on the passage between acidity and alkalinity. Reagents are substances used for the detection or determination of another substance by chemical or microscopical means, especially analysis. Types of reagents are precipitants, solvents, oxidizers, reducers, fluxes, and colorimetric reagents. (From Grant & Hackh's Chemical Dictionary, 5th ed, p301, p499) Indicator,Reagent,Reagents,Indicators,Reagents and Indicators
D008722 Methods A series of steps taken in order to conduct research. Techniques,Methodological Studies,Methodological Study,Procedures,Studies, Methodological,Study, Methodological,Method,Procedure,Technique
D009838 Oligodeoxyribonucleotides A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties. Oligodeoxynucleotide,Oligodeoxyribonucleotide,Oligodeoxynucleotides
D009841 Oligonucleotides Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed) Oligonucleotide
D012116 Resins, Plant Flammable, amorphous, vegetable products of secretion or disintegration, usually formed in special cavities of plants. They are generally insoluble in water and soluble in alcohol, carbon tetrachloride, ether, or volatile oils. They are fusible and have a conchoidal fracture. They are the oxidation or polymerization products of the terpenes, and are mixtures of aromatic acids and esters. Most are soft and sticky, but harden after exposure to cold. (From Grant & Hackh's Chemical Dictionary, 5th ed & Dorland, 28th ed) Plant Resins
D002851 Chromatography, High Pressure Liquid Liquid chromatographic techniques which feature high inlet pressures, high sensitivity, and high speed. Chromatography, High Performance Liquid,Chromatography, High Speed Liquid,Chromatography, Liquid, High Pressure,HPLC,High Performance Liquid Chromatography,High-Performance Liquid Chromatography,UPLC,Ultra Performance Liquid Chromatography,Chromatography, High-Performance Liquid,High-Performance Liquid Chromatographies,Liquid Chromatography, High-Performance
D002852 Chromatography, Ion Exchange Separation technique in which the stationary phase consists of ion exchange resins. The resins contain loosely held small ions that easily exchange places with other small ions of like charge present in solutions washed over the resins. Chromatography, Ion-Exchange,Ion-Exchange Chromatography,Chromatographies, Ion Exchange,Chromatographies, Ion-Exchange,Ion Exchange Chromatographies,Ion Exchange Chromatography,Ion-Exchange Chromatographies
D001483 Base Sequence The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence. DNA Sequence,Nucleotide Sequence,RNA Sequence,DNA Sequences,Base Sequences,Nucleotide Sequences,RNA Sequences,Sequence, Base,Sequence, DNA,Sequence, Nucleotide,Sequence, RNA,Sequences, Base,Sequences, DNA,Sequences, Nucleotide,Sequences, RNA

Related Publications

A F Markham, and M D Edge, and T C Atkinson, and A R Greene, and G R Heathcliffe, and C R Newton, and D Scanlon
Rapid synthesis of oligodeoxyribonucleotides. VII. Solid phase synthesis of oligodeoxyribonucleotides by a continuous flow phosphotriester method on a kieselguhr-polyamide support.
October 1982, Nucleic acids research,
A F Markham, and M D Edge, and T C Atkinson, and A R Greene, and G R Heathcliffe, and C R Newton, and D Scanlon
Continuous-flow phosphotriester method for solid-phase synthesis of oligodeoxyribonucleotides.
January 1983, Cold Spring Harbor symposia on quantitative biology,
A F Markham, and M D Edge, and T C Atkinson, and A R Greene, and G R Heathcliffe, and C R Newton, and D Scanlon
Rapid synthesis of oligodeoxyribonucleotides. V. Further studies in solid phase synthesis of oligodeoxyribonucleotides through phosphotriester intermediates.
January 1980, Nucleic acids symposium series,
A F Markham, and M D Edge, and T C Atkinson, and A R Greene, and G R Heathcliffe, and C R Newton, and D Scanlon
Solid phase synthesis of polynucleotides. VIII. Synthesis of mixed oligodeoxyribonucleotides by the phosphotriester solid phase method.
January 1983, Nucleic acids research,
A F Markham, and M D Edge, and T C Atkinson, and A R Greene, and G R Heathcliffe, and C R Newton, and D Scanlon
Rapid synthesis of oligodeoxyribonucleotides VI. Efficient, mechanised synthesis of heptadecadeoxyribonucleotides by an improved solid phase phosphotriester route.
April 1981, Nucleic acids research,
A F Markham, and M D Edge, and T C Atkinson, and A R Greene, and G R Heathcliffe, and C R Newton, and D Scanlon
Synthesis of oligodeoxyribonucleotides by solid phase phosphotriester method on a reduced scale; preparation of oligonucleotides for improved promoter sequence.
January 1982, Nucleic acids symposium series,
A F Markham, and M D Edge, and T C Atkinson, and A R Greene, and G R Heathcliffe, and C R Newton, and D Scanlon
Silica gel: an improved support for the solid-phase phosphotriester synthesis of oligonucleotides.
November 1982, Nucleic acids research,
A F Markham, and M D Edge, and T C Atkinson, and A R Greene, and G R Heathcliffe, and C R Newton, and D Scanlon
Improvements to solid phase phosphotriester synthesis of deoxyoligonucleotides.
September 1982, Nucleic acids research,
A F Markham, and M D Edge, and T C Atkinson, and A R Greene, and G R Heathcliffe, and C R Newton, and D Scanlon
First synthesis of alternating SATE-phosphotriester/phosphodiester prooligonucleotides on solid support.
October 1998, Bioorganic & medicinal chemistry letters,
A F Markham, and M D Edge, and T C Atkinson, and A R Greene, and G R Heathcliffe, and C R Newton, and D Scanlon
A polyamide support for solid-phase protein sequencing.
April 1976, FEBS letters,
Copied contents to your clipboard!