Biomaterial Database

Fluorescence-detected interactions of oligonucleotides in RecA complexes. 1995

P Wittung, and M Funk, and B Jernström, and B Nordén, and M Takahashi

Department of Physical Chemistry, Chalmers University of Technology, Gothenburg, Sweden.

A technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA. The 24-mer oligonucleotide 5'-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATP gamma S, binding of two oligonucleotides, identical or complementary in sequence, in the RecA filament is possible. The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed. In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changes, and we now find protein-mediated renaturation to occur.

UI	MeSH Term	Description	Entries
D008969	Molecular Sequence Data	Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.	Sequence Data, Molecular,Molecular Sequencing Data,Data, Molecular Sequence,Data, Molecular Sequencing,Sequencing Data, Molecular
D009695	Nucleic Acid Renaturation	The reformation of all, or part of, the native conformation of a nucleic acid molecule after the molecule has undergone denaturation.	Acid Renaturation, Nucleic,Acid Renaturations, Nucleic,Nucleic Acid Renaturations,Renaturation, Nucleic Acid,Renaturations, Nucleic Acid
D009838	Oligodeoxyribonucleotides	A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.	Oligodeoxynucleotide,Oligodeoxyribonucleotide,Oligodeoxynucleotides
D011485	Protein Binding	The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.	Plasma Protein Binding Capacity,Binding, Protein
D011817	Rabbits	A burrowing plant-eating mammal with hind limbs that are longer than its fore limbs. It belongs to the family Leporidae of the order Lagomorpha, and in contrast to hares, possesses 22 instead of 24 pairs of chromosomes.	Belgian Hare,New Zealand Rabbit,New Zealand Rabbits,New Zealand White Rabbit,Rabbit,Rabbit, Domestic,Chinchilla Rabbits,NZW Rabbits,New Zealand White Rabbits,Oryctolagus cuniculus,Chinchilla Rabbit,Domestic Rabbit,Domestic Rabbits,Hare, Belgian,NZW Rabbit,Rabbit, Chinchilla,Rabbit, NZW,Rabbit, New Zealand,Rabbits, Chinchilla,Rabbits, Domestic,Rabbits, NZW,Rabbits, New Zealand,Zealand Rabbit, New,Zealand Rabbits, New,cuniculus, Oryctolagus
D011938	Rec A Recombinases	A family of recombinases initially identified in BACTERIA. They catalyze the ATP-driven exchange of DNA strands in GENETIC RECOMBINATION. The product of the reaction consists of a duplex and a displaced single-stranded loop, which has the shape of the letter D and is therefore called a D-loop structure.	Rec A Protein,RecA Protein,Recombinases, Rec A
D004247	DNA	A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).	DNA, Double-Stranded,Deoxyribonucleic Acid,ds-DNA,DNA, Double Stranded,Double-Stranded DNA,ds DNA
D005456	Fluorescent Dyes	Chemicals that emit light after excitation by light. The wave length of the emitted light is usually longer than that of the incident light. Fluorochromes are substances that cause fluorescence in other substances, i.e., dyes used to mark or label other compounds with fluorescent tags.	Flourescent Agent,Fluorescent Dye,Fluorescent Probe,Fluorescent Probes,Fluorochrome,Fluorochromes,Fluorogenic Substrates,Fluorescence Agents,Fluorescent Agents,Fluorogenic Substrate,Agents, Fluorescence,Agents, Fluorescent,Dyes, Fluorescent,Probes, Fluorescent,Substrates, Fluorogenic
D000255	Adenosine Triphosphate	An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.	ATP,Adenosine Triphosphate, Calcium Salt,Adenosine Triphosphate, Chromium Salt,Adenosine Triphosphate, Magnesium Salt,Adenosine Triphosphate, Manganese Salt,Adenylpyrophosphate,CaATP,CrATP,Manganese Adenosine Triphosphate,MgATP,MnATP,ATP-MgCl2,Adenosine Triphosphate, Chromium Ammonium Salt,Adenosine Triphosphate, Magnesium Chloride,Atriphos,Chromium Adenosine Triphosphate,Cr(H2O)4 ATP,Magnesium Adenosine Triphosphate,Striadyne,ATP MgCl2
D000818	Animals	Unicellular or multicellular, heterotrophic organisms, that have sensation and the power of voluntary movement. Under the older five kingdom paradigm, Animalia was one of the kingdoms. Under the modern three domain model, Animalia represents one of the many groups in the domain EUKARYOTA.	Animal,Metazoa,Animalia