Biomaterial Database

Discrimination of respiratory syncytial virus subgroups A and B by reverse transcription-PCR. 1996

J Gottschalk, and R Zbinden, and L Kaempf, and I Heinzer

Institute of Microbiology, Kantonsspital, Aarau, Switzerland.

Reverse transcription (RT)-PCR with shared primers differentiating respiratory syncytial virus (RSV) subgroups A and B was developed for subtyping of RSV isolates. Results of RT-PCR were compared with those of an indirect immunofluorescence test using monoclonal antibodies. Viral RNA isolated from cell cultures infected with RSV served as a template for cDNA synthesis with random primers. For PCR, we used three synthetic oligonucleotides corresponding to the G protein mRNA sequence of subgroup A (bases 248 to 267; 3'ATGCAACAAGCCAGATCAAG), subgroup B (bases 314 to 333; 3'ACTCATCCAAACAACCCACA), or both (bases 511 to 530; 3'GGWACAAARTTGAACACTTC). PCR products of RSV subgroups A and B had molecular sizes of 283 and 217 bp, respectively. Specific cutting sites for RSV A and B in amplified cDNA were demonstrated by restriction fragment analysis with four restriction endonucleases. Our RT-PCR assay divided 68 RSV isolates into 47 strains of subgroup A and 21 strains of subgroup B in full agreement with subtyping by monoclonal antibodies. RT-PCR seems to be a good alternative to subtyping of RSV with monoclonal antibodies.

UI	MeSH Term	Description	Entries
D008969	Molecular Sequence Data	Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.	Sequence Data, Molecular,Molecular Sequencing Data,Data, Molecular Sequence,Data, Molecular Sequencing,Sequencing Data, Molecular
D004279	DNA, Viral	Deoxyribonucleic acid that makes up the genetic material of viruses.	Viral DNA
D005069	Evaluation Studies as Topic	Works about studies that determine the effectiveness or value of processes, personnel, and equipment, or the material on conducting such studies.	Critique,Evaluation Indexes,Evaluation Methodology,Evaluation Report,Evaluation Research,Methodology, Evaluation,Pre-Post Tests,Qualitative Evaluation,Quantitative Evaluation,Theoretical Effectiveness,Use-Effectiveness,Critiques,Effectiveness, Theoretical,Evaluation Methodologies,Evaluation Reports,Evaluation, Qualitative,Evaluation, Quantitative,Evaluations, Qualitative,Evaluations, Quantitative,Indexes, Evaluation,Methodologies, Evaluation,Pre Post Tests,Pre-Post Test,Qualitative Evaluations,Quantitative Evaluations,Report, Evaluation,Reports, Evaluation,Research, Evaluation,Test, Pre-Post,Tests, Pre-Post,Use Effectiveness
D006801	Humans	Members of the species Homo sapiens.	Homo sapiens,Man (Taxonomy),Human,Man, Modern,Modern Man
D000911	Antibodies, Monoclonal	Antibodies produced by a single clone of cells.	Monoclonal Antibodies,Monoclonal Antibody,Antibody, Monoclonal
D001483	Base Sequence	The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.	DNA Sequence,Nucleotide Sequence,RNA Sequence,DNA Sequences,Base Sequences,Nucleotide Sequences,RNA Sequences,Sequence, Base,Sequence, DNA,Sequence, Nucleotide,Sequence, RNA,Sequences, Base,Sequences, DNA,Sequences, Nucleotide,Sequences, RNA
D016133	Polymerase Chain Reaction	In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.	Anchored PCR,Inverse PCR,Nested PCR,PCR,Anchored Polymerase Chain Reaction,Inverse Polymerase Chain Reaction,Nested Polymerase Chain Reaction,PCR, Anchored,PCR, Inverse,PCR, Nested,Polymerase Chain Reactions,Reaction, Polymerase Chain,Reactions, Polymerase Chain
D017931	DNA Primers	Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.	DNA Primer,Oligodeoxyribonucleotide Primer,Oligodeoxyribonucleotide Primers,Oligonucleotide Primer,Oligonucleotide Primers,Primer, DNA,Primer, Oligodeoxyribonucleotide,Primer, Oligonucleotide,Primers, DNA,Primers, Oligodeoxyribonucleotide,Primers, Oligonucleotide
D018076	DNA, Complementary	Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.	Complementary DNA,cDNA,cDNA Probes,Probes, cDNA
D018113	Respiratory Syncytial Virus, Human	The type species of PNEUMOVIRUS and an important cause of lower respiratory disease in infants and young children. It frequently presents with bronchitis and bronchopneumonia and is further characterized by fever, cough, dyspnea, wheezing, and pallor.	HRSV Human respiratory syncytial virus,Human respiratory syncytial virus,human RSV,RSV, human,human RSVs