The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis. 2002

Andrzej Wilk, and Marcin K Chmielewski, and Andrzej Grajkowski, and Lawrence R Phillips, and Serge L Beaucage
Division of Therapeutic Proteins, Center for Biologics Evaluation and Research, Food and Drug Administration, 8800 Rockville Pike, Bethesda, Maryland 20892, USA.

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

UI MeSH Term Description Entries
D008401 Gas Chromatography-Mass Spectrometry A microanalytical technique combining mass spectrometry and gas chromatography for the qualitative as well as quantitative determinations of compounds. Chromatography, Gas-Liquid-Mass Spectrometry,Chromatography, Gas-Mass Spectrometry,GCMS,Spectrometry, Mass-Gas Chromatography,Spectrum Analysis, Mass-Gas Chromatography,Gas-Liquid Chromatography-Mass Spectrometry,Mass Spectrometry-Gas Chromatography,Chromatography, Gas Liquid Mass Spectrometry,Chromatography, Gas Mass Spectrometry,Chromatography, Mass Spectrometry-Gas,Chromatography-Mass Spectrometry, Gas,Chromatography-Mass Spectrometry, Gas-Liquid,Gas Chromatography Mass Spectrometry,Gas Liquid Chromatography Mass Spectrometry,Mass Spectrometry Gas Chromatography,Spectrometries, Mass-Gas Chromatography,Spectrometry, Gas Chromatography-Mass,Spectrometry, Gas-Liquid Chromatography-Mass,Spectrometry, Mass Gas Chromatography,Spectrometry-Gas Chromatography, Mass,Spectrum Analysis, Mass Gas Chromatography
D009838 Oligodeoxyribonucleotides A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties. Oligodeoxynucleotide,Oligodeoxyribonucleotide,Oligodeoxynucleotides
D009943 Organophosphorus Compounds Organic compounds that contain phosphorus as an integral part of the molecule. Included under this heading is broad array of synthetic compounds that are used as PESTICIDES and DRUGS. Organophosphorus Compound,Organopyrophosphorus Compound,Organopyrophosphorus Compounds,Compound, Organophosphorus,Compound, Organopyrophosphorus,Compounds, Organophosphorus,Compounds, Organopyrophosphorus
D002384 Catalysis The facilitation of a chemical reaction by material (catalyst) that is not consumed by the reaction. Catalyses
D002625 Chemistry, Organic The study of the structure, preparation, properties, and reactions of carbon compounds. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed) Organic Chemistry
D004591 Electrophoresis, Polyacrylamide Gel Electrophoresis in which a polyacrylamide gel is used as the diffusion medium. Polyacrylamide Gel Electrophoresis,SDS-PAGE,Sodium Dodecyl Sulfate-PAGE,Gel Electrophoresis, Polyacrylamide,SDS PAGE,Sodium Dodecyl Sulfate PAGE,Sodium Dodecyl Sulfate-PAGEs
D006863 Hydrogen-Ion Concentration The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH pH,Concentration, Hydrogen-Ion,Concentrations, Hydrogen-Ion,Hydrogen Ion Concentration,Hydrogen-Ion Concentrations
D001483 Base Sequence The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence. DNA Sequence,Nucleotide Sequence,RNA Sequence,DNA Sequences,Base Sequences,Nucleotide Sequences,RNA Sequences,Sequence, Base,Sequence, DNA,Sequence, Nucleotide,Sequence, RNA,Sequences, Base,Sequences, DNA,Sequences, Nucleotide,Sequences, RNA
D015394 Molecular Structure The location of the atoms, groups or ions relative to one another in a molecule, as well as the number, type and location of covalent bonds. Structure, Molecular,Molecular Structures,Structures, Molecular
D019906 Nuclear Magnetic Resonance, Biomolecular NMR spectroscopy on small- to medium-size biological macromolecules. This is often used for structural investigation of proteins and nucleic acids, and often involves more than one isotope. Biomolecular Nuclear Magnetic Resonance,Heteronuclear Nuclear Magnetic Resonance,NMR Spectroscopy, Protein,NMR, Biomolecular,NMR, Heteronuclear,NMR, Multinuclear,Nuclear Magnetic Resonance, Heteronuclear,Protein NMR Spectroscopy,Biomolecular NMR,Heteronuclear NMR,Multinuclear NMR,NMR Spectroscopies, Protein,Protein NMR Spectroscopies,Spectroscopies, Protein NMR,Spectroscopy, Protein NMR

Related Publications

Andrzej Wilk, and Marcin K Chmielewski, and Andrzej Grajkowski, and Lawrence R Phillips, and Serge L Beaucage
December 2003, The Journal of organic chemistry,
Andrzej Wilk, and Marcin K Chmielewski, and Andrzej Grajkowski, and Lawrence R Phillips, and Serge L Beaucage
December 2004, Current protocols in nucleic acid chemistry,
Andrzej Wilk, and Marcin K Chmielewski, and Andrzej Grajkowski, and Lawrence R Phillips, and Serge L Beaucage
September 1990, International journal of peptide and protein research,
Andrzej Wilk, and Marcin K Chmielewski, and Andrzej Grajkowski, and Lawrence R Phillips, and Serge L Beaucage
April 2004, The Journal of organic chemistry,
Andrzej Wilk, and Marcin K Chmielewski, and Andrzej Grajkowski, and Lawrence R Phillips, and Serge L Beaucage
January 1988, Nucleic acids symposium series,
Andrzej Wilk, and Marcin K Chmielewski, and Andrzej Grajkowski, and Lawrence R Phillips, and Serge L Beaucage
February 2000, Organic letters,
Andrzej Wilk, and Marcin K Chmielewski, and Andrzej Grajkowski, and Lawrence R Phillips, and Serge L Beaucage
November 2001, Bioorganic & medicinal chemistry letters,
Andrzej Wilk, and Marcin K Chmielewski, and Andrzej Grajkowski, and Lawrence R Phillips, and Serge L Beaucage
November 1994, Gene,
Andrzej Wilk, and Marcin K Chmielewski, and Andrzej Grajkowski, and Lawrence R Phillips, and Serge L Beaucage
February 2007, The Journal of organic chemistry,
Andrzej Wilk, and Marcin K Chmielewski, and Andrzej Grajkowski, and Lawrence R Phillips, and Serge L Beaucage
April 2021, ChemistryOpen,
Copied contents to your clipboard!