-transparent.png){kind=logo}
The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.
Related Publications
E C Koper-Zwarthoff, and
R E Lockard, and
B Alzner-deWeerd, and
U L RajBhandary, and
J F Bol
May 1980,
Nucleic acids research,
E C Koper-Zwarthoff, and
R E Lockard, and
B Alzner-deWeerd, and
U L RajBhandary, and
J F Bol
March 1979,
Proceedings of the National Academy of Sciences of the United States of America,
E C Koper-Zwarthoff, and
R E Lockard, and
B Alzner-deWeerd, and
U L RajBhandary, and
J F Bol
March 1983,
Nucleic acids research,
E C Koper-Zwarthoff, and
R E Lockard, and
B Alzner-deWeerd, and
U L RajBhandary, and
J F Bol
May 1983,
Nucleic acids research,
E C Koper-Zwarthoff, and
R E Lockard, and
B Alzner-deWeerd, and
U L RajBhandary, and
J F Bol
April 1994,
Journal of virology,
E C Koper-Zwarthoff, and
R E Lockard, and
B Alzner-deWeerd, and
U L RajBhandary, and
J F Bol
September 1969,
Nature,
E C Koper-Zwarthoff, and
R E Lockard, and
B Alzner-deWeerd, and
U L RajBhandary, and
J F Bol
May 1975,
European journal of biochemistry,
E C Koper-Zwarthoff, and
R E Lockard, and
B Alzner-deWeerd, and
U L RajBhandary, and
J F Bol
May 1983,
Virology,
E C Koper-Zwarthoff, and
R E Lockard, and
B Alzner-deWeerd, and
U L RajBhandary, and
J F Bol
November 1980,
Biochemistry,
E C Koper-Zwarthoff, and
R E Lockard, and
B Alzner-deWeerd, and
U L RajBhandary, and
J F Bol
March 1983,
Virology,
