BIOMAT Database Logo BIOMAT Database Logo

The nucleotide sequence of bacteriophage T5 glutamine transfer RNA. 1984

M G Shlyapnikov, and A V Kaliman, and S I Kazantsev, and V M Kryukov, and A A Bayev

Uniformly 32P-labeled phage-specific tRNAGln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAG psi CGAGAUCAUUGGT psi CAAAUCCAAUAUCCCCUGCCAOH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5'-terminal base and the fifth base from its 3'-end. The structure of tRNA was confirmed by DNA sequencing of its gene.

UI MeSH Term Description Entries
D009690 Nucleic Acid Conformation The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape. DNA Conformation,RNA Conformation,Conformation, DNA,Conformation, Nucleic Acid,Conformation, RNA,Conformations, DNA,Conformations, Nucleic Acid,Conformations, RNA,DNA Conformations,Nucleic Acid Conformations,RNA Conformations
D004279 DNA, Viral Deoxyribonucleic acid that makes up the genetic material of viruses. Viral DNA
D005796 Genes A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms. Cistron,Gene,Genetic Materials,Cistrons,Genetic Material,Material, Genetic,Materials, Genetic
D005814 Genes, Viral The functional hereditary units of VIRUSES. Viral Genes,Gene, Viral,Viral Gene
D005973 Glutamine A non-essential amino acid present abundantly throughout the body and is involved in many metabolic processes. It is synthesized from GLUTAMIC ACID and AMMONIA. It is the principal carrier of NITROGEN in the body and is an important energy source for many cells. D-Glutamine,L-Glutamine,D Glutamine,L Glutamine
D001483 Base Sequence The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence. DNA Sequence,Nucleotide Sequence,RNA Sequence,DNA Sequences,Base Sequences,Nucleotide Sequences,RNA Sequences,Sequence, Base,Sequence, DNA,Sequence, Nucleotide,Sequence, RNA,Sequences, Base,Sequences, DNA,Sequences, Nucleotide,Sequences, RNA
D012343 RNA, Transfer The small RNA molecules, 73-80 nucleotides long, that function during translation (TRANSLATION, GENETIC) to align AMINO ACIDS at the RIBOSOMES in a sequence determined by the mRNA (RNA, MESSENGER). There are about 30 different transfer RNAs. Each recognizes a specific CODON set on the mRNA through its own ANTICODON and as aminoacyl tRNAs (RNA, TRANSFER, AMINO ACYL), each carries a specific amino acid to the ribosome to add to the elongating peptide chains. Suppressor Transfer RNA,Transfer RNA,tRNA,RNA, Transfer, Suppressor,Transfer RNA, Suppressor,RNA, Suppressor Transfer
D013604 T-Phages A series of 7 virulent phages which infect E. coli. The T-even phages T2, T4; (BACTERIOPHAGE T4), and T6, and the phage T5 are called "autonomously virulent" because they cause cessation of all bacterial metabolism on infection. Phages T1, T3; (BACTERIOPHAGE T3), and T7; (BACTERIOPHAGE T7) are called "dependent virulent" because they depend on continued bacterial metabolism during the lytic cycle. The T-even phages contain 5-hydroxymethylcytosine in place of ordinary cytosine in their DNA. Bacteriophages T,Coliphages T,Phages T,T Phages,T-Phage

Related Publications

M G Shlyapnikov, and A V Kaliman, and S I Kazantsev, and V M Kryukov, and A A Bayev
The nucleotide sequence of bacteriophage T5 leucine tRNA.
November 1985, FEBS letters,
M G Shlyapnikov, and A V Kaliman, and S I Kazantsev, and V M Kryukov, and A A Bayev
The nucleotide sequence of threonine transfer RNA coded by bacteriophage T4.
June 1978, Nucleic acids research,
M G Shlyapnikov, and A V Kaliman, and S I Kazantsev, and V M Kryukov, and A A Bayev
Nucleotide sequence of a glycine transfer RNA coded by bacteriophage T4.
November 1973, FEBS letters,
M G Shlyapnikov, and A V Kaliman, and S I Kazantsev, and V M Kryukov, and A A Bayev
[Features of the structure of transfer RNA coded by bacteriophage T5].
January 1994, Molekuliarnaia biologiia,
M G Shlyapnikov, and A V Kaliman, and S I Kazantsev, and V M Kryukov, and A A Bayev
Nucleotide alterations in the bacteriophage T4 glutamine transfer RNA that affect ochre suppressor activity.
December 1974, Journal of molecular biology,
M G Shlyapnikov, and A V Kaliman, and S I Kazantsev, and V M Kryukov, and A A Bayev
The nucleotide sequence of the region of bacteriophage T5 early genes D10-D15.
November 1988, Nucleic acids research,
M G Shlyapnikov, and A V Kaliman, and S I Kazantsev, and V M Kryukov, and A A Bayev
Complete genome sequence of bacteriophage T5.
February 2005, Virology,
M G Shlyapnikov, and A V Kaliman, and S I Kazantsev, and V M Kryukov, and A A Bayev
Nucleotide sequence of the bacteriophage T5 DNA fragment which contains the gene for tRNAAsp.
April 1986, European journal of biochemistry,
M G Shlyapnikov, and A V Kaliman, and S I Kazantsev, and V M Kryukov, and A A Bayev
The nucleotide sequence of the dimeric precursor to glutamine and leucine transfer RNAs coded by bacteriophage T4.
July 1975, Journal of molecular biology,
M G Shlyapnikov, and A V Kaliman, and S I Kazantsev, and V M Kryukov, and A A Bayev
The nucleotide sequence of bacteriophage T5 DNA at the region between early and late genes.
July 1988, Nucleic acids research,
Copied contents to your clipboard!