Biomaterial Database

On the phylogeny of Phycomyces blakesleeanus. Nucleotide sequence of 5 S ribosomal RNA. 1982

J Andersen, and W Andresini, and N Delihas

The nucleotide sequence of the major 5 S ribosomal RNA from the lower fungus Phycomyces blakesleeanus has been determined. The sequence is 5' AAUCUACGGCCAUACAGAUAGUAACACACCGGAUCCCGUCUGAUCUCCGCAGUUAAGUCUCUCCUGGUAGCGUCAGUAC UAUGGUGGGGGACCACAUGGGAAUACGCUAUGUCGUAGGUU3'OH. The Phycomyces 5 S RNA sequence has invariant nucleotide positions characteristic of other eukaryotic 5 S RNAs and fits currently proposed secondary structural models. The Phycomyces of 5 S RNA shows relatively low overall sequence homology to the higher fungal (Ascomycetes) 5 S RNAs (56-60%) but shows higher sequence homology to those 5 S RNAs from Tetrahymena thermophila (68%), human KB cells (67%), and Spinacia oleracea (62%). A comparison of individual segments of the RNA also shows that the structure of Phycomyces 5 S RNA has several major differences from structures common to the higher fungi. Positions 2-14 are homologous with those of metazoan and some protozoan 5 S RNAs. At positions 30-45, the RNA sequence is closer to metazoan 5 S RNAs than to the Neurospora of Aspergillus 5 S RNAs. The Phycomyces 5 S RNA shares similar sequences with both Aspergillus and Tetrahymena 5 S RNAs at positions 79-99. Several other important homologies in primary and proposed secondary structures also have been observed in comparing Phycomyces 5 S RNA with animal and plant 5 S RNAs. We conclude that Phycomyces may not be as closely related phylogenetically to the Ascomycetes as previously thought.

UI	MeSH Term	Description	Entries
D009690	Nucleic Acid Conformation	The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.	DNA Conformation,RNA Conformation,Conformation, DNA,Conformation, Nucleic Acid,Conformation, RNA,Conformations, DNA,Conformations, Nucleic Acid,Conformations, RNA,DNA Conformations,Nucleic Acid Conformations,RNA Conformations
D010800	Phycomyces	A genus of zygomycetous fungi in the family Mucoraceae, order MUCORALES, forming mycelia having a metallic sheen. It has been used for research on phototropism.	Phycomyce
D005658	Fungi	A kingdom of eukaryotic, heterotrophic organisms that live parasitically as saprobes, including MUSHROOMS; YEASTS; smuts, molds, etc. They reproduce either sexually or asexually, and have life cycles that range from simple to complex. Filamentous fungi, commonly known as molds, refer to those that grow as multicellular colonies.	Fungi, Filamentous,Molds,Filamentous Fungi,Filamentous Fungus,Fungus,Fungus, Filamentous,Mold
D001483	Base Sequence	The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.	DNA Sequence,Nucleotide Sequence,RNA Sequence,DNA Sequences,Base Sequences,Nucleotide Sequences,RNA Sequences,Sequence, Base,Sequence, DNA,Sequence, Nucleotide,Sequence, RNA,Sequences, Base,Sequences, DNA,Sequences, Nucleotide,Sequences, RNA
D012335	RNA, Ribosomal	The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)	Ribosomal RNA,15S RNA,RNA, 15S