Biomaterial Database

Escherichia coli tyrosine transfer ribonucleic acid genes. Nucleotide sequences of their promoters and of the regions adjoining C-C-A ends. 1976

R Contreras, and H Küpper, and A Landy, and H G Khorana

The template-dependent primer elongation method for determining DNA sequences of specific regions (e.g. Loewen, P., Sekiaya, T., and Khorana, H. G. (1974) J. Biol. Chem. 249, 217-226) has been applied to the determination of the sequences of the promoters and of the regions beyond the C-C-A ends of the tyrosine tRNA genes in Escherichia coli. The following results have been obtained. (a) The promoter of the tRNA1Tyr (su+) gene in the bacteriophage phi80psu+III (the singlet strain) and phi80psu+-III (the doublet strain) and, significantly, the promoter of the tRNA2Tyr gene in the bacteriophage lambdah80dglyTsu+36 all have the following identical sequence in the first 59 nucleotides: (see article) Transcription begins at the underlined terminal nucleotide and proceeds to the right. (b) tRNA1Tyr (su+) as present in the singlet strain phi80psu+III and the tRNA1Tyr (su-), the second gene in the doublet strain phi80psu+-III, have the following identical sequence beyond the C-C-A sequences: (5') TCACTTCAAAAGTCCTGAACT (3') (c) tRNA1Tyr (su+), the first gene in the doublet strain phi80psu+-III, has the sequence (5') TAATTCACCACAGGG (CA) (3'), and tRNA2Tyr in lambdah80dglyTsu+36 has the sequence (5') ATTTCGGCCACGCGA (TGCGG) (3') beyond the C-C-A nucleotides.

UI	MeSH Term	Description	Entries
D009693	Nucleic Acid Hybridization	Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)	Genomic Hybridization,Acid Hybridization, Nucleic,Acid Hybridizations, Nucleic,Genomic Hybridizations,Hybridization, Genomic,Hybridization, Nucleic Acid,Hybridizations, Genomic,Hybridizations, Nucleic Acid,Nucleic Acid Hybridizations
D009838	Oligodeoxyribonucleotides	A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.	Oligodeoxynucleotide,Oligodeoxyribonucleotide,Oligodeoxynucleotides
D009843	Oligoribonucleotides	A group of ribonucleotides (up to 12) in which the phosphate residues of each ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
D002855	Chromatography, Thin Layer	Chromatography on thin layers of adsorbents rather than in columns. The adsorbent can be alumina, silica gel, silicates, charcoals, or cellulose. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)	Chromatography, Thin-Layer,Thin Layer Chromatography,Chromatographies, Thin Layer,Chromatographies, Thin-Layer,Thin Layer Chromatographies,Thin-Layer Chromatographies,Thin-Layer Chromatography
D004269	DNA, Bacterial	Deoxyribonucleic acid that makes up the genetic material of bacteria.	Bacterial DNA
D004926	Escherichia coli	A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.	Alkalescens-Dispar Group,Bacillus coli,Bacterium coli,Bacterium coli commune,Diffusely Adherent Escherichia coli,E coli,EAggEC,Enteroaggregative Escherichia coli,Enterococcus coli,Diffusely Adherent E. coli,Enteroaggregative E. coli,Enteroinvasive E. coli,Enteroinvasive Escherichia coli
D006163	Ribonuclease T1	An enzyme catalyzing the endonucleolytic cleavage of RNA at the 3'-position of a guanylate residue. EC 3.1.27.3.	Guanyloribonuclease,RNase T1,Ribonuclease N1,Aspergillus oryzae Ribonuclease,Guanyl-Specific RNase,RNase Apl,RNase F1,RNase Pch 1,RNase ST,Ribonuclease F1,Ribonuclease F2,Ribonuclease ST,Ribonuclease T-1,T 1 RNase,Guanyl Specific RNase,RNase, Guanyl-Specific,RNase, T 1,Ribonuclease T 1,Ribonuclease, Aspergillus oryzae
D001483	Base Sequence	The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.	DNA Sequence,Nucleotide Sequence,RNA Sequence,DNA Sequences,Base Sequences,Nucleotide Sequences,RNA Sequences,Sequence, Base,Sequence, DNA,Sequence, Nucleotide,Sequence, RNA,Sequences, Base,Sequences, DNA,Sequences, Nucleotide,Sequences, RNA
D012260	Ribonucleases	Enzymes that catalyze the hydrolysis of ester bonds within RNA. EC 3.1.-.	Nucleases, RNA,RNase,Acid Ribonuclease,Alkaline Ribonuclease,Ribonuclease,RNA Nucleases,Ribonuclease, Acid,Ribonuclease, Alkaline
D012343	RNA, Transfer	The small RNA molecules, 73-80 nucleotides long, that function during translation (TRANSLATION, GENETIC) to align AMINO ACIDS at the RIBOSOMES in a sequence determined by the mRNA (RNA, MESSENGER). There are about 30 different transfer RNAs. Each recognizes a specific CODON set on the mRNA through its own ANTICODON and as aminoacyl tRNAs (RNA, TRANSFER, AMINO ACYL), each carries a specific amino acid to the ribosome to add to the elongating peptide chains.	Suppressor Transfer RNA,Transfer RNA,tRNA,RNA, Transfer, Suppressor,Transfer RNA, Suppressor,RNA, Suppressor Transfer